1) Single Allele: Arm Color= BB/Bb(blue) bb(red)
Single Allele: Body Color= RR/Rr(blue) rr(red)
Single Allele: Leg Color= PP/Pp(blue) pp(red)
Codominant: Face= OO(orange) oo(yellow) Oo(both) *Red is his face being shadowed
Multiple: Profession= PP(pirate) NN(Ninja) Cowboy(CC)
Incomplete: Fire Control= FF(both hands) ff(no control) Ff(one hand)
Sex-Linked: Morality= XY(hero) X'Y(villain)
XX(hero) X'X(hero) XX(villain)
Friday, February 26, 2010
Part III: Creature DNA Fingerprinting
TATCCTGATATCACTATATGTATATCGATATACTGAGATATACCCATATA
ATAGGACTATAGTGATATACATATAGCTATATGACTCTATATGGGTATAT
ATAGGACTATAGTGATATACATATAGCTATATGACTCTATATGGGTATAT
Wednesday, February 24, 2010
Part I: Debate
My topic, which I am against, is the issue on gender correction for medical reasons. Lets start with the case of the infant who had most of his penis burned off during his circumcision. Doctors decided to alter the boy's genitalia to resemble that of a vagina, and he lived the rest of his life as a girl.
I'm strongly against this for a few reasons, one of which being that I believe the doctors should have made more of an effort to save his penis, instead of performing the sex change. The doctors could have performed a skin graph on the damaged tissue and make more of an effort to save it, rather than perform a sex-change. There are multiple options to this issue, rather than jumping to the sex change.
Another reason I am against this is the child's body is already wired to develop like a boy, so when "she" gets older "she" could end up with some harmful medical illnesses. Also, the amount of trauma of the "girl" developing manly features would be too much for the person, which could lead to mental insanity.
My final reason for why I am against the changing of a he to a she for medical reasons, and vise versa, is that I do not believe our society is ready yet for these cases (sex changed individuals). Overall, I think society's reactions to these people would be a mixture of confusion, disgust, or maybe even fear, which will have a negative impact on the sex changed person.
Reflection: I think the debate went fairly well, although I picked up on some instances where I believed I could have done better. Also, it wasn't until after the debate, that I realized I could've argued with what Alyssa had said, but overall I think I did well.
Another reason I am against this is the child's body is already wired to develop like a boy, so when "she" gets older "she" could end up with some harmful medical illnesses. Also, the amount of trauma of the "girl" developing manly features would be too much for the person, which could lead to mental insanity.
My final reason for why I am against the changing of a he to a she for medical reasons, and vise versa, is that I do not believe our society is ready yet for these cases (sex changed individuals). Overall, I think society's reactions to these people would be a mixture of confusion, disgust, or maybe even fear, which will have a negative impact on the sex changed person.
Reflection: I think the debate went fairly well, although I picked up on some instances where I believed I could have done better. Also, it wasn't until after the debate, that I realized I could've argued with what Alyssa had said, but overall I think I did well.
Subscribe to:
Posts (Atom)
